View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12881_low_23 (Length: 327)
Name: NF12881_low_23
Description: NF12881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12881_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 20 - 314
Target Start/End: Complemental strand, 36884974 - 36884680
Alignment:
| Q |
20 |
agcaaggatatctctttgcattctcatccaaccagtgcaagcataggtaatttatacagagaagcatatggatagtgaggcactctataatctgtttttg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36884974 |
agcaaggatatctctttgcattctcatccaaccagtgcaagcataggtaatttatacagagaagcatatggatagtaaggcactctataatctgtttttg |
36884875 |
T |
|
| Q |
120 |
tcatttttgctgagaagaccttgataaaatcttgaaaaataatacgaatttgagattgtattggaaattcacnnnnnnngtgtaataatcaactagctac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
36884874 |
tcatttttgctgagaagaccttgataaaatcttgaaaaataatacgaatttgagattgtatttgaaattcactttttttgtgtaataatcaactagctac |
36884775 |
T |
|
| Q |
220 |
ctcactgagttaggatgccattaatatttctgtgaattcatttctaatgctaatcatgctctcnnnnnnncttcctattggtgatagaggtctct |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
36884774 |
ctcactgagttaggatgccattaatatttctgtgaattcatttctaatgctaatcatgctatctttttttcttcctattggtgatagaggtctct |
36884680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University