View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12881_low_29 (Length: 282)
Name: NF12881_low_29
Description: NF12881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12881_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 19 - 204
Target Start/End: Complemental strand, 42003562 - 42003377
Alignment:
| Q |
19 |
gtgaagggtgccccactatattagtagagaccataacaatttatctagtttatgccaaaacaatcttgtctattttttactcttgnnnnnnnntaatgct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
42003562 |
gtgaagggtgccccactatattagtagagaccataacaatttatctagtttatgccaaaacaatcttgtcttttttttactcttgaaaaaaaataatgct |
42003463 |
T |
 |
| Q |
119 |
aacaaatgttcttaaaacactagttaagaaaacgtatataataatttattttgaaatttgtgcaaaaaatactcttttcaatgaaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42003462 |
aacaaatgttcttaaaacactagttaagaaaacgtatataataatttattttgaaatttgtgcacaaaatactcttttcaatgaaa |
42003377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University