View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12881_low_32 (Length: 250)
Name: NF12881_low_32
Description: NF12881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12881_low_32 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 31087825 - 31087586
Alignment:
| Q |
1 |
ttgtaatgttaaataagtatagcaactgctttgtatagttttcaggtataatctttt--gagttttctctccctgcccgttctttccaactgctttgtta |
98 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31087825 |
ttgtaatgttaaataagtataacaactgctttgtttagttttcaggtataatctttttagagttttctctccctgctcgttctttccaactgctttgtta |
31087726 |
T |
 |
| Q |
99 |
gtaaatatataggttccacttaggtgacatatcttt-actcatttaaagttattttctaaaaatgaagcttgtttaatttataaaaatgttttcaatttt |
197 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31087725 |
gtaaagatatgggttccacttaggtgacatatcttttactcatttaaagttattttctaaaaatgaagcttgtttaatttataaaaatgttttcaatttt |
31087626 |
T |
 |
| Q |
198 |
cattattttgaaaggaccc----tatgggaagtaattaga |
233 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31087625 |
cattattttgaaaggaccctatatatgggaagtaattaga |
31087586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University