View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12881_low_39 (Length: 238)
Name: NF12881_low_39
Description: NF12881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12881_low_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 42003623 - 42003846
Alignment:
| Q |
1 |
ttaaattagctgtctctctcgaagacaagtttcaatttcaagacctgcaaggctggagaacactcttaacgttcatgaatctgtcaagatcacatgattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42003623 |
ttaaattagctgtctctctcgaagacaagtttcaatttcaagacctgcaaggctggagaacactcttaacgttcatgaatctgtcaagatcacatgattt |
42003722 |
T |
 |
| Q |
101 |
taacaaactctaaggtagacaatgcattaatgtctatgggaccaacacatgtatcttctagtaaaacatacacaatgtactatacgttactttcaaagtc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42003723 |
taacaaactctaaggtagacaatgcattaatgtctatgggaccaacacatgtatcttctagtaaaacatacacaatgtactatacgttactttcaaagtt |
42003822 |
T |
 |
| Q |
201 |
ggtaacacaacatatgtcttaatt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
42003823 |
ggtaacacaacatatgtcttaatt |
42003846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 4 - 145
Target Start/End: Original strand, 42012373 - 42012519
Alignment:
| Q |
4 |
aattagctgtctctct-cgaagacaagtttcaatttcaagacctgcaaggctggagaacactctt-aacgttcatgaatctgtcaaga-------tcaca |
94 |
Q |
| |
|
|||||||||||| ||| | ||||||| ||||||||||| || ||||||||||||| |||||||| ||| |||||||||| |||| | ||||| |
|
|
| T |
42012373 |
aattagctgtctatctgctaagacaattttcaatttcatgatctgcaaggctgga--acactctttaacattcatgaatccatcaacaccatatatcaca |
42012470 |
T |
 |
| Q |
95 |
tgattttaacaaactctaaggtagacaatgcattaatgtctatgggaccaa |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
42012471 |
tgattttaacaaactctaaggtagacaatgcatt--tgtctttgggaccaa |
42012519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University