View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12881_low_41 (Length: 235)
Name: NF12881_low_41
Description: NF12881
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12881_low_41 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 14 - 142
Target Start/End: Complemental strand, 2480863 - 2480735
Alignment:
| Q |
14 |
caaaggcattaggcaccaatcgatcatggtacaacgtaacaagttcagaggagttagacaacgacagtggggctcatgggtctcagaaattcgtcaccct |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2480863 |
caaaggcattaggcaccaatcgatcatggtacaacgtaacaagttcagaggagttagacaacgacagtggggctcatgggtctcagaaattcgtcaccct |
2480764 |
T |
|
| Q |
114 |
ttactgtaatctacttctccaacactata |
142 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2480763 |
ttactgtaatctacttctccaacactata |
2480735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 54 - 115
Target Start/End: Original strand, 49532342 - 49532403
Alignment:
| Q |
54 |
aagttcagaggagttagacaacgacagtggggctcatgggtctcagaaattcgtcacccttt |
115 |
Q |
| |
|
|||||||||||||| || || || ||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
49532342 |
aagttcagaggagtcaggcagcgccagtggggctcttgggtgtcagaaattcgccacccttt |
49532403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University