View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12882_high_34 (Length: 351)
Name: NF12882_high_34
Description: NF12882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12882_high_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 194 - 339
Target Start/End: Original strand, 41367088 - 41367233
Alignment:
| Q |
194 |
ttaaggaataagagaaatttgatgaggatattaatcctgagggacatggttaaggtagaagagttggtggatatgaaaggggtaaatttttgccccaatc |
293 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
41367088 |
ttaaggaataagagtaatttgatgaggatattaatcctgagggacatggttaaggtagaagagttggtggatatgaaaggggtaaatttttgcaccaatc |
41367187 |
T |
|
| Q |
294 |
ctatcttggtaatttttgcaataattattgtgttcttagggacctt |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41367188 |
ctatcttggtaatttttgcaataattattgtgttcttagggacctt |
41367233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 14 - 157
Target Start/End: Original strand, 41366947 - 41367090
Alignment:
| Q |
14 |
caaggatcatcaagataaaggtgttgtttgatatatctcagctatttatgaaaagaatgtacataggaaacgaaaatgatgggatatgtaggctaggttt |
113 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41366947 |
caaggatcatcaagataaaggtattgtttgatatatctcagctatttatggaaagaatgtacataggaaacgaaaatgatgggatatgtaggctaggttt |
41367046 |
T |
|
| Q |
114 |
taggtacgtgaatctcactatgttttgctttaattgtggtctta |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41367047 |
taggtacgtgaatctcactatgttttgctttaattgtggtctta |
41367090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University