View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12882_high_38 (Length: 312)
Name: NF12882_high_38
Description: NF12882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12882_high_38 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 19 - 142
Target Start/End: Complemental strand, 26606519 - 26606391
Alignment:
| Q |
19 |
gttgggaattgggatatgctttactctcatgaaagttggtcttctcttctcagtactagagttattaga-----aatggaaaagcaataaatcatcacan |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
26606519 |
gttgggaattgggatatgctttactctcatgaaagttggtcttctcttctcaatactagagttattagattagaactggaaaagcaataaatcatcacat |
26606420 |
T |
 |
| Q |
114 |
nnnnnncatctatctggtcaagcataaaa |
142 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
26606419 |
ttttttcatctatctggtcaagcataaaa |
26606391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University