View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12882_high_54 (Length: 247)
Name: NF12882_high_54
Description: NF12882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12882_high_54 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 5 - 166
Target Start/End: Original strand, 29091717 - 29091880
Alignment:
| Q |
5 |
tcacttttcgagattacaattggtcaaggtgatcaacaagattgctatgatgttagcatggttgatggatgcaatcttccaatgcttgttctacca--ag |
102 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| ||||||||||||| |||||| |||||||||||||||||| || |
|
|
| T |
29091717 |
tcacttttcgagattacaattggacaaggtgatcaacaagattactatgatgttagtatggttgatggatacaatctcccaatgcttgttctaccaagag |
29091816 |
T |
 |
| Q |
103 |
gtgtatatggtaatagtgcatgtaatgccgcaggttgtgtgactgatattaacagaggtatgag |
166 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29091817 |
gtgtatatggtaaaagtgcatgtaatgccacaggttgtgtgactgatattaacagaggtatgag |
29091880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 7 - 94
Target Start/End: Original strand, 29084380 - 29084467
Alignment:
| Q |
7 |
acttttcgagattacaattggtcaaggtgatcaacaagattgctatgatgttagcatggttgatggatgcaatcttccaatgcttgtt |
94 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29084380 |
acttttcgagattacaattggtcaaggtgatcaacaagattgctatgatgttagcatggttgatggatgcaatcttccaatgcttgtt |
29084467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University