View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12882_high_57 (Length: 239)
Name: NF12882_high_57
Description: NF12882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12882_high_57 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 28 - 228
Target Start/End: Original strand, 30337226 - 30337426
Alignment:
| Q |
28 |
ccacccggcattgtttgccgttactcctactttcatcttcttcagtatcgcaaactaagatcacacgttgttgagatgaacttcggcaactatgatgccg |
127 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30337226 |
ccacccggcgttgtttgccgttactcctactttcatcttcttaagtatcgcaaactaagatcacacgttgttgagatgaacttcggcaactatgattccg |
30337325 |
T |
|
| Q |
128 |
atgaaaaacaaaatcccaccctaccttgctcccataatgctacctttaactcaactcttttcacccctttcaactaccttggaaaactcatcttcagtga |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30337326 |
atgaaaaacaaaatcccaccctaccttgctcccataatgctacctttaactcaactcttttcacccctttcaactaccttggaaaactcatcttccgtga |
30337425 |
T |
|
| Q |
228 |
a |
228 |
Q |
| |
|
| |
|
|
| T |
30337426 |
a |
30337426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 20 - 81
Target Start/End: Original strand, 30325581 - 30325642
Alignment:
| Q |
20 |
gcttcccaccacccggcattgtttgccgttactcctactttcatcttcttcagtatcgcaaa |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
30325581 |
gcttcccaccacccggcattgtttgccgttactcctactttcattttcttcagtatcgcaaa |
30325642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University