View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12882_high_58 (Length: 229)
Name: NF12882_high_58
Description: NF12882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12882_high_58 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 22 - 214
Target Start/End: Original strand, 30398673 - 30398877
Alignment:
| Q |
22 |
attaacgtactggccacaacaaaagcagaataaacaagnnnnnnnncacattcagttagcaaagttctccaatcactgggatcctgatattgatttgata |
121 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30398673 |
attaacgtactggtcacaacaaaagcagaataaacaagaaaaaaaacacattcagttagcaaagttctccaatcactgggatcctgatattgatttgata |
30398772 |
T |
 |
| Q |
122 |
cagaatattgcataagcagtgcctta-----------ggatcagaggtggttatctgcattgttagaag-actctctcaaaatcttccataaacctcatc |
209 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30398773 |
cagaatattgcataagcagtgccttaggatcagaggtggatcagaggtggttatctgcattgttagaagaactctctcaaaatcttccataaacctcatc |
30398872 |
T |
 |
| Q |
210 |
ctttg |
214 |
Q |
| |
|
||||| |
|
|
| T |
30398873 |
ctttg |
30398877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University