View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12882_high_59 (Length: 229)
Name: NF12882_high_59
Description: NF12882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12882_high_59 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 19 - 204
Target Start/End: Original strand, 5211556 - 5211739
Alignment:
| Q |
19 |
tgttttgcaactagcttcctagcctaaccctctgtttggctttttctttgcagtaagatacggttttgaacttttggtataatcgacgacataacagcta |
118 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5211556 |
tgttttgcaactagcttcctatcctaacactctgtttggctctttctttgcagtaagatacggttttgaacttttggtataatcgacgacataacagcta |
5211655 |
T |
|
| Q |
119 |
catgaaatgacacatagctaggtttgtgatatgtgtaatttcgacctagaacttgttttctttatagatatcaggtgttattatta |
204 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5211656 |
catgaaatgacacatagctaggtttgtg--atgtgtaatttcgacctagaacttgttttctttatagatatctggtgttattatta |
5211739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 228
Target Start/End: Complemental strand, 17266070 - 17266038
Alignment:
| Q |
196 |
ttattattatggcttaattgcacttttggaccc |
228 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
17266070 |
ttattattttggcttaattgcacttttggaccc |
17266038 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 228
Target Start/End: Original strand, 33621856 - 33621888
Alignment:
| Q |
196 |
ttattattatggcttaattgcacttttggaccc |
228 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
33621856 |
ttattattaaggcttaattgcacttttggaccc |
33621888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 228
Target Start/End: Original strand, 49056113 - 49056145
Alignment:
| Q |
196 |
ttattattatggcttaattgcacttttggaccc |
228 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
49056113 |
ttattattttggcttaattgcacttttggaccc |
49056145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University