View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12882_low_28 (Length: 417)
Name: NF12882_low_28
Description: NF12882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12882_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 278; Significance: 1e-155; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 22 - 332
Target Start/End: Complemental strand, 27701623 - 27701313
Alignment:
| Q |
22 |
tgccacctccattgctgagtgaggagaatttgaaggttttgattgaaaaagaatgtcatcacttgcctgctagtgattatgtcaataggctgaaaaatgg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27701623 |
tgccacctccattgctgagtgaggagaatttgaaggttttgattgaaaaagaatgtcatcacttgcctgctagtgattatgtcaataggctgaaaaatgg |
27701524 |
T |
|
| Q |
122 |
tgaattggatttgcagggcaggatggaatccattgattggatggaaaaggtggggtccacatttatttgattcttaatttctcattaatttttagggttt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27701523 |
agaattggatttgcagggcaggatggaatccattgattggatggaaaaggtggggtccacatttatttgattcttaatttctcattaatttttagggttt |
27701424 |
T |
|
| Q |
222 |
caactatatgtgagttcattttctcttttgctagttccaatgttatgtacattgtttttctttaatctcnnnnnnnattgacaattaatattctttaatc |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
27701423 |
caactatatgtgagttcattttctcttttgctagttccaatgttatgtgcattgtttttctttaatctctttttttattgaaaattaatattctttaatc |
27701324 |
T |
|
| Q |
322 |
ttggcatgtga |
332 |
Q |
| |
|
||||||||||| |
|
|
| T |
27701323 |
ttggcatgtga |
27701313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University