View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12882_low_29 (Length: 415)
Name: NF12882_low_29
Description: NF12882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12882_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 2 - 241
Target Start/End: Complemental strand, 3338411 - 3338170
Alignment:
| Q |
2 |
gggttgtgggatccaccatgagtgcattggatggagcatannnnnnnnnnnn--gccgacaaagggcatctttggatgcatgggttttagtatttgcgca |
99 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3338411 |
gggttgtggggtccaccatgagtgcattggatggagcataagagagagagagaggccgacaaagggcatctttggatgcatgggttttagtatttgcgca |
3338312 |
T |
|
| Q |
100 |
cgcacgggagttgttattctcaatatatatcaatgacttgtgattaatatcatattattatcactaattaattttaggtaggtttcagagatttcagagt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3338311 |
cgcacgggagttgttattctcaatatatatcaatgacttgtgattaatatcatattattatcactaattaattttaggtaggtttcagagatttcagagt |
3338212 |
T |
|
| Q |
200 |
aattcagctaactcttcggtgctttccactgtctttttgtga |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3338211 |
aattcagctaactcttcggtgctttccactgtctttttgtga |
3338170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 288 - 397
Target Start/End: Complemental strand, 3338127 - 3338018
Alignment:
| Q |
288 |
aacagcaacactgatctggattatgcggtcaaccccatgccaacttaactacactctgtactctttctttctccatccattatatgcaccaaacctcacc |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3338127 |
aacagcaacactgatctggattatgcggtcaaccccatgccaacttaactacactctgtactctttctttctccatccattatatgcaccaaacctcacc |
3338028 |
T |
|
| Q |
388 |
aacaaatatc |
397 |
Q |
| |
|
|||||||||| |
|
|
| T |
3338027 |
aacaaatatc |
3338018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University