View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12882_low_32 (Length: 381)

Name: NF12882_low_32
Description: NF12882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12882_low_32
NF12882_low_32
[»] chr7 (2 HSPs)
chr7 (10-147)||(36446142-36446279)
chr7 (284-371)||(36446387-36446472)


Alignment Details
Target: chr7 (Bit Score: 94; Significance: 9e-46; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 10 - 147
Target Start/End: Original strand, 36446142 - 36446279
Alignment:
10 agaacctgtgatactgtaaccaaaaaagaacatgtgatactacctattacttatgatactccctatccctatactattgattatatgatgtacttggttc 109  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |||||||||     
36446142 agaacctgtgatactgtaaccaaaaaagaacctgtgatactacctattacttatgatactccctatacccatactattgattatatgatctacttggttt 36446241  T
110 aactcttatcnnnnnnnncttagataatttaagtttgg 147  Q
    ||||||||||        ||||||||||||||||||||    
36446242 aactcttatcttttttatcttagataatttaagtttgg 36446279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 284 - 371
Target Start/End: Original strand, 36446387 - 36446472
Alignment:
284 gcacatgttaaaatttcctttaacatgaccctaccaattttaatttgaaaaagattggaagagagtgagcaaaggagtgggacctatg 371  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||    
36446387 gcacatgttaaaatttcctt-aacatgaccctaccaattttaatttgaaaaagattggaagagagtgagc-aaggagtggaacctatg 36446472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University