View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12882_low_32 (Length: 381)
Name: NF12882_low_32
Description: NF12882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12882_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 9e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 10 - 147
Target Start/End: Original strand, 36446142 - 36446279
Alignment:
| Q |
10 |
agaacctgtgatactgtaaccaaaaaagaacatgtgatactacctattacttatgatactccctatccctatactattgattatatgatgtacttggttc |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || ||||||||||||||||||| ||||||||| |
|
|
| T |
36446142 |
agaacctgtgatactgtaaccaaaaaagaacctgtgatactacctattacttatgatactccctatacccatactattgattatatgatctacttggttt |
36446241 |
T |
|
| Q |
110 |
aactcttatcnnnnnnnncttagataatttaagtttgg |
147 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |
|
|
| T |
36446242 |
aactcttatcttttttatcttagataatttaagtttgg |
36446279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 284 - 371
Target Start/End: Original strand, 36446387 - 36446472
Alignment:
| Q |
284 |
gcacatgttaaaatttcctttaacatgaccctaccaattttaatttgaaaaagattggaagagagtgagcaaaggagtgggacctatg |
371 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
36446387 |
gcacatgttaaaatttcctt-aacatgaccctaccaattttaatttgaaaaagattggaagagagtgagc-aaggagtggaacctatg |
36446472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University