View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12882_low_49 (Length: 264)
Name: NF12882_low_49
Description: NF12882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12882_low_49 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 198; Significance: 1e-108; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 15 - 232
Target Start/End: Complemental strand, 32739761 - 32739544
Alignment:
| Q |
15 |
gaaggcaagtgcgaccgctgtgatttttacaagtgactgtcggtttggaattggaatgtgcatttgtgttgcggacaagatgttcgtctaggcaaaacta |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32739761 |
gaaggcaagtgcgaccgctgtgatttttacaagtgactgtcggtttggaattggaatgtgcatttgtgttgcggacaagatgttcgtctaggcaaaacta |
32739662 |
T |
 |
| Q |
115 |
ttgagttttatagacaagcttgtacttgtccaactaacttagtagctgaaaccatgtcgacgatgatggagtgtgtcaagctactttttctgttggcctt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32739661 |
ttgagttttatagacaagcttgtacttgtccaactcacttagtagctgaaaccatgtcgacaacgatggagtgtgtcaagctactttttctgttggcctc |
32739562 |
T |
 |
| Q |
215 |
gcttccctgatatacact |
232 |
Q |
| |
|
||||||||| |||||||| |
|
|
| T |
32739561 |
gcttccctggtatacact |
32739544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 38 - 213
Target Start/End: Original strand, 29133227 - 29133400
Alignment:
| Q |
38 |
tttttacaagtgactgtcggtttggaattggaatgtgcatttgtgttgcggacaagatgttcgtctaggcaaaactattgagttttatagacaagcttgt |
137 |
Q |
| |
|
|||||| | ||||||||||| ||||||| |||||||||| |||||| | ||||||| || |||||||| | ||||||| |||||| ||||||| |
|
|
| T |
29133227 |
tttttaaatgtgactgtcggcttggaataataatgtgcattcatgttgccaaggagatgtttgttgaggcaaaa--actgagtttgatagacgagcttgt |
29133324 |
T |
 |
| Q |
138 |
acttgtccaactaacttagtagctgaaaccatgtcgacgatgatggagtgtgtcaagctactttttctgttggcct |
213 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
29133325 |
tcttgtccaacttacttactagctgaaaccatgtcgacaacgatggagtgtgtcaagctactttttctgttggcct |
29133400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University