View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12882_low_52 (Length: 262)

Name: NF12882_low_52
Description: NF12882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12882_low_52
NF12882_low_52
[»] chr4 (1 HSPs)
chr4 (1-262)||(23444965-23445224)


Alignment Details
Target: chr4 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 262
Target Start/End: Original strand, 23444965 - 23445224
Alignment:
1 gagcatctgggttgcaggttttagactatgacatatgtccactacacaagtagtcaagtcagggacccacccacccccacacaactttgttgcactttga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23444965 gagcatctgggttgcaggttttagactatgacatatgtccactacacaagtagtcaagtcagggacccacccacccccacacaactttgttgcactttga 23445064  T
101 tgtacgaaaacgcgtcaataatgtgtatgaaaattgaaaggaagtagtccccagccccacactctctgctgctgaactttcaaagaagttgcacataaca 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||    
23445065 tgtacgaaaacgcgtcaataatgtgtatgaaaattgaaaggaagtagtccccagccccaca--ctctgctgctgaactttcaaagaagttgcacataaca 23445162  T
201 tagtttatcaagagtaaagtagagaaatgtgttctataaagcaaaggttaagacattagtct 262  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23445163 tagtttatcaagagtaaagtagagaaatgtgttctataaagcaaaggttaagacattagtct 23445224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University