View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12882_low_55 (Length: 250)
Name: NF12882_low_55
Description: NF12882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12882_low_55 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 44238598 - 44238836
Alignment:
| Q |
11 |
cacagacaccagaaactgaaactcaaactgctgaatcttgtgtcaatttgggtcttgagctattttccaaaggaaaggtatagtttattatcttcaaaat |
110 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44238598 |
cacagacaccagaaactgaaactgaaactgctgaatcttgtgtcaatttgggtcttgagctattttccaaaggaaaggtatagtttattatcttcaaaat |
44238697 |
T |
 |
| Q |
111 |
tttatcttttagtattcaaactatgatgtttaagtgggtccttcaaagttgtgnnnnnnnattatggattcttcaggttaaagatgctttggcccagttt |
210 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44238698 |
tttatcttttagtattcaaattatgatgtttaagtgggtccttcaaagttgtg-ttttttattatggattcttcaggttaaagatgctttggcccagttt |
44238796 |
T |
 |
| Q |
211 |
gaaacagcactttctttgaatcctaatcctgttgaggccc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44238797 |
gaaacagcactttctttgaatcctaatcctgttgaggccc |
44238836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University