View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12882_low_64 (Length: 227)
Name: NF12882_low_64
Description: NF12882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12882_low_64 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 30 - 207
Target Start/End: Complemental strand, 14581125 - 14580948
Alignment:
| Q |
30 |
aataaataaataacctcgtaaatcttagtgcatgttcctataatattcctggtccaccagtgaccagtggtaagcaaccacttgcaaacagtacatgtca |
129 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| ||| |
|
|
| T |
14581125 |
aataaataaaaagcctcgtaaatcttagtgcatgttcctataatattcctggtccaccagtgaccagtggtaagtaaccacttgcaaacggtacatatca |
14581026 |
T |
|
| Q |
130 |
atcagccaccgtagcaccattatcattattacaatagatttcacaagttgagtcaaaaaacaaagttgaattcaaatt |
207 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14581025 |
aacagccaccgtagcaccattatcattattacaatagatttcacaagttgagtcaaaaaacaaagttgaattcaaatt |
14580948 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 86
Target Start/End: Original strand, 14542462 - 14542518
Alignment:
| Q |
30 |
aataaataaataacctcgtaaatcttagtgcatgttcctataatattcctggtccac |
86 |
Q |
| |
|
||||||||| |||||| ||||||| ||||||||||| ||||||||| ||||||||| |
|
|
| T |
14542462 |
aataaataataaacctcataaatctcagtgcatgttcatataatatttctggtccac |
14542518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University