View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12882_low_66 (Length: 223)
Name: NF12882_low_66
Description: NF12882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12882_low_66 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 14 - 207
Target Start/End: Original strand, 42893913 - 42894106
Alignment:
| Q |
14 |
acagaggaagaagatgagtagaagaaacggaagtgggccaaagctagatttgaagctgaatttgtcaccaccaagggtgaacagaagaatggaatcatca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42893913 |
acagaggaagaagatgagtagaagaaacggaagtgggccaaagctagatttgaagctgaatttgtcaccaccaagggtgaacagaagaatggaatcatca |
42894012 |
T |
|
| Q |
114 |
ccaacacgatcagcgtcggtgtcgccgccgagttcatgtgtttcatctgagaatggatcaagcagccctgaagcaacctccatgctgttagtag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42894013 |
ccaacacgatcagcgtcggtgtcgccgccgagttcatgtgtttcatctgagaatggatcaagcagccctgaagcaacctccatgctgttagtag |
42894106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University