View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12882_low_67 (Length: 205)
Name: NF12882_low_67
Description: NF12882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12882_low_67 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 19 - 173
Target Start/End: Complemental strand, 32444931 - 32444773
Alignment:
| Q |
19 |
atgtttaatattaaacaattgatttatccttgagaattttagtctcaaattaattttttatgtataaattttcgaaaggtaattggaaaaaacaagggat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||| |
|
|
| T |
32444931 |
atgtttaatattaaacaattgatttatccttgagaattttagtctcaaattaattttttatgtataaattttggaaaggtaattggaaaaaacaagtgat |
32444832 |
T |
 |
| Q |
119 |
aatatggtttgggaataactattattct----tagtgataaagaaatcgtgtgttcaac |
173 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
32444831 |
aatatggtttgggaataactattattcttagttagtgataaagaaatcctgtgttcaac |
32444773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University