View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12882_low_67 (Length: 205)

Name: NF12882_low_67
Description: NF12882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12882_low_67
NF12882_low_67
[»] chr1 (1 HSPs)
chr1 (19-173)||(32444773-32444931)


Alignment Details
Target: chr1 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 19 - 173
Target Start/End: Complemental strand, 32444931 - 32444773
Alignment:
19 atgtttaatattaaacaattgatttatccttgagaattttagtctcaaattaattttttatgtataaattttcgaaaggtaattggaaaaaacaagggat 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||    
32444931 atgtttaatattaaacaattgatttatccttgagaattttagtctcaaattaattttttatgtataaattttggaaaggtaattggaaaaaacaagtgat 32444832  T
119 aatatggtttgggaataactattattct----tagtgataaagaaatcgtgtgttcaac 173  Q
    ||||||||||||||||||||||||||||    |||||||||||||||| ||||||||||    
32444831 aatatggtttgggaataactattattcttagttagtgataaagaaatcctgtgttcaac 32444773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University