View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12883_high_2 (Length: 416)
Name: NF12883_high_2
Description: NF12883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12883_high_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 154; Significance: 1e-81; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 105 - 303
Target Start/End: Original strand, 4841297 - 4841499
Alignment:
| Q |
105 |
ggcaccaccggtgtatggtacgaaccttggttgctaaaggatcctttatgcaatcttgtaccgtttgttcatattcaagatattgatcttcaaatcaaat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
4841297 |
ggcaccaccggtgtatggtacgaaccttggttgctaaaggatcctttataccatcttgtaccatttgtacatattcaagatattgatcttcaaatcaaat |
4841396 |
T |
 |
| Q |
205 |
atgttatttgtaacgc----gggaggtaatctgcaaaatgtttacaccatgctaccgctgatgttcaaacgtaaatttcagaaaccaaggctctcctggt |
300 |
Q |
| |
|
||||||||| |||||| || |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
4841397 |
atgttatttctaacgcaggaggtaggtaatctgcaaaatgtttacaccatgctgccgctgatgttcaaacgtaaatttcagaaaccaaggctctcctgtt |
4841496 |
T |
 |
| Q |
301 |
gga |
303 |
Q |
| |
|
||| |
|
|
| T |
4841497 |
gga |
4841499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 76; E-Value: 5e-35
Query Start/End: Original strand, 325 - 400
Target Start/End: Original strand, 4841495 - 4841570
Alignment:
| Q |
325 |
ttggagtcattgtacctcaggtatctatacaacaaagtctgggtatagatggttgaatcgtgaagatacatagttc |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4841495 |
ttggagtcattgtacctcaggtatctatacaacaaagtctgggtatagatggttgaatcgtgaagatacatagttc |
4841570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 29 - 100
Target Start/End: Original strand, 4839398 - 4839469
Alignment:
| Q |
29 |
ccttgcgaaaaatagtaagagctcacctattttgaatgctattgttaaagcctttcaaatgatgaaggatgg |
100 |
Q |
| |
|
|||||||| |||| | ||| |||||||| ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4839398 |
ccttgcgagaaatggcaagggctcacctgtttggaatgctattgttaaagcctttcaaatgatgaaggatgg |
4839469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 121 - 199
Target Start/End: Original strand, 48542804 - 48542882
Alignment:
| Q |
121 |
ggtacgaaccttggttgctaaaggatcctttatgcaatcttgtaccgtttgttcatattcaagatattgatcttcaaat |
199 |
Q |
| |
|
|||||||||||||||||||||| |||| | |||| ||||||| | |||||||| || |||||||||||||||||||| |
|
|
| T |
48542804 |
ggtacgaaccttggttgctaaaagatcatgtatgtcatcttgtgtcatttgttcaaatacaagatattgatcttcaaat |
48542882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University