View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12883_low_7 (Length: 308)
Name: NF12883_low_7
Description: NF12883
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12883_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 18 - 298
Target Start/End: Original strand, 25296057 - 25296341
Alignment:
| Q |
18 |
acttctccctgcgaactcacttctgaactatgaggaactaaacaatattca----tcatcatcatcttcttctgcattgtggccaactcaggcccatgat |
113 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||| |||||||||||| ||||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25296057 |
acttctccctgcgacctcacttctgagctatgaggaaccaaacaatattcactgatcatcttcttcttcttctgcattgtggccaactcaggcccatgat |
25296156 |
T |
|
| Q |
114 |
cttccccaccacggtgcattgccaaatgtggcaaatgcatcccatgcatagcaatggtggggaatgttggaatttcagccgggaatttccctcaagcctg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
25296157 |
cttccccaccacggtgcattgccaaatgtggcaaatgcatcccatgcatagcaatggtggggaatgttggaatttcagtcgggtatttccctcaagcctg |
25296256 |
T |
|
| Q |
214 |
gaggtgcttttgcggagggaaattctacaatccatgaagcatgctacgagaagagaaccactgttgtgattagttagaagtttct |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25296257 |
gaggtgcttttgcggagggaaattctacaatccatgaagcatgctacgagaagagaaccactgttgtgatcagttagaagtttct |
25296341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University