View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12884_high_13 (Length: 285)
Name: NF12884_high_13
Description: NF12884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12884_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 7 - 269
Target Start/End: Complemental strand, 13116836 - 13116571
Alignment:
| Q |
7 |
cgttggagaaagtgtcgggaggtggcttttggcgacgaacaacggcattggaaccattgcggttgcgtcgtcgtggttgtcgaggttgtggttcttccac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13116836 |
cgttggagaaagtgtcgggaggtggcttttggcgacgagcaacggcactggaaccattgcggttgcgtcgtcgtggttgtcgaggttgtggttcttccac |
13116737 |
T |
 |
| Q |
107 |
atgatcctcatcaaggatgcgcagcaattgcatcaatgatgccattgttagcaagctagcttggaagagctaaagttttagatgcctt-gtaggagatgt |
205 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||||||||||| | || ||||||||||| ||| |||||||||||||||| ||||||||||| |
|
|
| T |
13116736 |
atgatcctcatcaaggaggttcagcaattgcatcaatgatgccattgttaactagttagcttggaagggctcaagttttagatgccttggtaggagatgt |
13116637 |
T |
 |
| Q |
206 |
tgcacccatctatatataga--atatgtatatgacttgcttaaggaataatatgtaggaccctgtt |
269 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13116636 |
tgcacccatctatatatagaatatatgtatatgacttgcttaaggaataatatgtaggaccctgtt |
13116571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University