View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12884_high_15 (Length: 250)
Name: NF12884_high_15
Description: NF12884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12884_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 35387823 - 35388035
Alignment:
| Q |
1 |
ttgttatatacacttccctcatgcaatttaagtttcaccataaatcctaacccctccccaggctaatggtactttaaaaagtagcctccaatcttaactg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
35387823 |
ttgttatatacacttccctcatgcaatttaagtttcaccataaatcctaacccctccccaggctaatggtactttaaaaagtagcctccaatcttaacgg |
35387922 |
T |
 |
| Q |
101 |
attttaaagaagtcgttgttctttattagcaattacaatcacatacagaagatattagtgaaccaactggcaacatttcattggttaatcatgcaaaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35387923 |
attttaaagaagtcgttgttctttattagcaattacaatcacatgcagaagatattagtgaaccaactggcaacatttcattggttaatcatgcaataaa |
35388022 |
T |
 |
| Q |
201 |
tcataggcttgtt |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
35388023 |
tcataggcttgtt |
35388035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University