View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12884_low_13 (Length: 305)
Name: NF12884_low_13
Description: NF12884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12884_low_13 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 305
Target Start/End: Complemental strand, 15724079 - 15723775
Alignment:
| Q |
1 |
cacaactctttgccaacgtaggtagtctgtaatggtcttgcctcccttgttgggcctttgattccggggctgaatcatctgactccaggatcgggcattg |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15724079 |
cacaactctttgccaacgtaggtggtctgtaatggacttgcctcccttgttgggcctttcattccggggctgaatcatctgactccaggatcgggcattg |
15723980 |
T |
 |
| Q |
101 |
acctagtccggaaatacagttgaagttgtgaggggtagaggaaatatgaaagaaagaagatgatttctattctttaacacacatttggttattttatccg |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15723979 |
accgagtccggaaatacagttgaagttgttaggggtagaggaaatatgaaagaaagaagatgattcctattctttaacacacatttggttattttatccg |
15723880 |
T |
 |
| Q |
201 |
gattattgtctgaattattttattttggaataattacttaactttaagtcttcgcttctttttattcttgctaaaccaatgcatttgaaatatttgaact |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15723879 |
gattattgtctgaattattttattttggaataattacttaactttaagtcttcgcttctttttattcttgctaaaccaatgcatttgaaatatttgaact |
15723780 |
T |
 |
| Q |
301 |
ttcct |
305 |
Q |
| |
|
||||| |
|
|
| T |
15723779 |
ttcct |
15723775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University