View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12884_low_16 (Length: 291)
Name: NF12884_low_16
Description: NF12884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12884_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 12 - 272
Target Start/End: Complemental strand, 28192506 - 28192246
Alignment:
| Q |
12 |
agagaagaatgatcgaataccttgtcgtgaactttcacaacactcacaatcaaataatcacatagatactcaaaagactattgagggtgcagaagctgga |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28192506 |
agagaagaatgatcgaataccttgtcgtgaactttcacagcactcacaatcaaataatcacatagatactcaaaagactattgagggtgcagaagctgga |
28192407 |
T |
|
| Q |
112 |
tgcctcctaatcagaaccgaagaccttataacttctgaagttgccgctagctgggcttgcagtactgctccttctttacatgaggaaaatgaaccttcaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28192406 |
tgcctcctaatcagaaccgaagaccttataacttctgaagttgccgctagctgggcttgcagtactgctccttctttacatgaggaaaatgaaccttcaa |
28192307 |
T |
|
| Q |
212 |
aaagcagagacaataatgaaggttcagggacattgaatgattcaaatattgtggtggcaga |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28192306 |
aaagcagagacaataatgaaggttcagggacattgaatgattcaaatattgtggtggcaga |
28192246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University