View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12884_low_24 (Length: 210)
Name: NF12884_low_24
Description: NF12884
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12884_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 191
Target Start/End: Complemental strand, 6138552 - 6138378
Alignment:
| Q |
17 |
cagagttccaagagagttcaaacaccgatcaaccacatcttcctccataactgtcaacatttccaaatcattgggctgtatttttgcagttgttgtttct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6138552 |
cagagttccaagagagttcaaacaccgatcaaccacatcttcctccataactgtcaacatttccaaatcattgggctgtatttttgcagttgttgtttct |
6138453 |
T |
 |
| Q |
117 |
ccatcgaaaagaacacaacagcatggatactttgttggaatgcgatgtcaatgctatacggaagatggaagcagg |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6138452 |
ccatcgaaaagaacacaacagcatggatactttgttggaatgcgatgtcaatgctatacggaagatggaagcagg |
6138378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 17 - 186
Target Start/End: Complemental strand, 6176641 - 6176472
Alignment:
| Q |
17 |
cagagttccaagagagttcaaacaccgatcaaccacatcttcctccataactgtcaacatttccaaatcattgggctgtatttttgcagttgttgtttct |
116 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||||||||||||||||||||||| ||||||||||||| ||| |||||| ||||||||||||||| |||||| |
|
|
| T |
6176641 |
cagagttccaagagagatcaaacaccaatcaaccacatcttcctccataactatcaacatttccaactcactgggctttatttttgcagttgtggtttct |
6176542 |
T |
 |
| Q |
117 |
ccatcgaaaagaacacaacagcatggatactttgttggaatgcgatgtcaatgctatacggaagatggaa |
186 |
Q |
| |
|
||||| || | ||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6176541 |
ccatctaagaaaacacaacagcatgggtacttcgttggaatgcgatgtcaatgctatacggaagatggaa |
6176472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University