View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12887_low_10 (Length: 261)
Name: NF12887_low_10
Description: NF12887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12887_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 23 - 245
Target Start/End: Complemental strand, 16468183 - 16467961
Alignment:
| Q |
23 |
aacggaaagctttgaagaagaaatgctattannnnnnnggacaatagtgcaaccaactccattgaaatttgataattctagctataacttgtaaacccaa |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||| ||| |||||||| |
|
|
| T |
16468183 |
aacggaaagctttgaagaagaaatgctattatttttttggaaaatagtgcaaccaactccattgaaatttgataattctagctgtaagttggaaacccaa |
16468084 |
T |
|
| Q |
123 |
ttttgtgcacaacacttattcctttcctcaacaatttttgtcacttaggttaaaatctagtaaaaataaaacggatagcagcaccagtctcttttcttcc |
222 |
Q |
| |
|
||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16468083 |
tttagtgtgcaacacttattcctttcctcaacaatttttgtcacttaggttaaaatctagtaaaaataaaacggatagcagcaccagtctcttttcttcc |
16467984 |
T |
|
| Q |
223 |
tttcaatcaatttcattattttt |
245 |
Q |
| |
|
||| ||||||||||||||||||| |
|
|
| T |
16467983 |
ttttaatcaatttcattattttt |
16467961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University