View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12887_low_11 (Length: 260)
Name: NF12887_low_11
Description: NF12887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12887_low_11 |
 | |
|
| [»] scaffold0236 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0236 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: scaffold0236
Description:
Target: scaffold0236; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 20 - 250
Target Start/End: Complemental strand, 12527 - 12298
Alignment:
| Q |
20 |
caaggcttgtgcccattgtgagctttgaggaaatgacaattaggataatatttttctttaaaacacatagcaataggagaatttggataattgatcaacc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12527 |
caaggcttgtgcccattgtgagctttgaggaaatgacaattaggataatatttttctttaaaacacatagcaataggagaatttggataattgatcaacc |
12428 |
T |
|
| Q |
120 |
tccaagactatttggcaaacataacttcaatgaagtctctaaaagttttgaaccccatgnnnnnnntccttcttggatgtacacaaagtggtccactttg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
12427 |
tccaagactatttggcaaacataacttcaatgaagtctctaaaagttttgaaccccatg-cccccctccttcttggatgtacacaaagtggtccactttg |
12329 |
T |
|
| Q |
220 |
tccagtgcaatttcttttaatccattctctg |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
12328 |
tccagtgcaatttcttttaatccattctctg |
12298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University