View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12887_low_12 (Length: 242)
Name: NF12887_low_12
Description: NF12887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12887_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 199
Target Start/End: Original strand, 5971949 - 5972148
Alignment:
| Q |
1 |
atagtgttgctattggaagaaagaagaaacaaaaagatgttgtttttcttggggttggtttttgaagc-agtcacttttggaggcaaagctcaattgcta |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5971949 |
atagtgttgctattggaagaaagaagaaacaaaaagatgttgcttttcttggggttggtttttgaagccagtcacttttggaggcaaagctcaattgcta |
5972048 |
T |
 |
| Q |
100 |
cccccctcccgatcttaggcaagatctcgatcttgatagaattgttatgcacgccaaattttacatgttgatgtaaagttctctattgaagcatgaattt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5972049 |
cccccctcccgatcttaggcaagatctcgatcttgatagaattgttatgcacgccaaattttacatgttgatgtaaagttctctattgaagcatgaattt |
5972148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 192 - 224
Target Start/End: Original strand, 5972162 - 5972194
Alignment:
| Q |
192 |
atgaatttatgttgactttacctacttatcaag |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5972162 |
atgaatttatgttgactttacctacttatcaag |
5972194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University