View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12887_low_14 (Length: 234)
Name: NF12887_low_14
Description: NF12887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12887_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 16 - 186
Target Start/End: Complemental strand, 36084341 - 36084171
Alignment:
| Q |
16 |
agagatgaaaaggaagaggaaatgtcaagatcagttctagcaatgtttagagaaaaggaagaagaaattgagagaagaaagttggaggttagagataagg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36084341 |
agagatgaaaaggaagaggaaatgtcaagatcagttctagcaatgtttagagaaaaggaagaagaaattgagagaagaaagttggaggttagagataagg |
36084242 |
T |
 |
| Q |
116 |
ttcatgctcatctcggtcgagtcgaaaaggaaacaaagcgattggctgagataagagaagtaagtccaata |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36084241 |
ttcatgctcatctcggtcgagtcgaaaaggaaacaaagcgattggctgagataagagaagtaagtccaata |
36084171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University