View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12888_high_11 (Length: 201)
Name: NF12888_high_11
Description: NF12888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12888_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 4e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 4e-80
Query Start/End: Original strand, 18 - 184
Target Start/End: Complemental strand, 32805115 - 32804949
Alignment:
| Q |
18 |
agctagtagctacttctgacacaaccatttaccctttttatgatctgggaactagagaaagaaaccactgtatgttagggtttctcaacacaaacttttt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32805115 |
agctagtagctacttctgacacaaccatttaccctttttatgatctgggaactagagaaagaatccactgcatgttagggtttctcaacacaaacttttt |
32805016 |
T |
 |
| Q |
118 |
ctgcatttggagtaacttattctacttgttttgagagacttcttctactacttcttcttcctcccac |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
32805015 |
ctgcatttggagtaacttattctacttgttttgagagactacttctactacttcttcttcatcccac |
32804949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 24 - 128
Target Start/End: Complemental strand, 32801913 - 32801809
Alignment:
| Q |
24 |
tagctacttctgacacaaccatttaccctttttatgatctgggaactagagaaagaaaccactgtatgttagggtttctcaacacaaactttttctgcat |
123 |
Q |
| |
|
||||| ||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32801913 |
tagcttcttctgacacatccatttaacctttttatgatctgggaactagagaaagaaaccactgcatgttagggtttctcaacacaaactttttctgcat |
32801814 |
T |
 |
| Q |
124 |
ttgga |
128 |
Q |
| |
|
||||| |
|
|
| T |
32801813 |
ttgga |
32801809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University