View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12888_low_7 (Length: 325)
Name: NF12888_low_7
Description: NF12888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12888_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 103 - 315
Target Start/End: Complemental strand, 44188645 - 44188433
Alignment:
| Q |
103 |
tcttatacgaattcggaatcggggacccgagattggttattgtatgaacaaggtatggcaaattatgtcccaactactgcatttgcaatctcattagaat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44188645 |
tcttatacgaattcggaatcggggacccgagattggttattgtatgaacaaggtatggcaaattatgtcccaactactgcatttgcaatctcattagaat |
44188546 |
T |
|
| Q |
203 |
gttgtcaaaagaattctttgatatctcaaacggaccactgatattggtcttgtttagcagccaacaaacttgccttagtgtcccagcattttgtaatgct |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44188545 |
gttgtcaaaagaattctttgatatctcaaacggaccactgatattggtcttgtttagcagccaacaaacttgccttagtgtcccagcattttgtaatgct |
44188446 |
T |
|
| Q |
303 |
aattggacctatg |
315 |
Q |
| |
|
||||||||||||| |
|
|
| T |
44188445 |
aattggacctatg |
44188433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 18 - 103
Target Start/End: Complemental strand, 44188767 - 44188682
Alignment:
| Q |
18 |
atagatgactggcagcaaccaattcctaggacacaacaggtgctgagaatgcttttgcaagagtagtgtactacctatggtataat |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44188767 |
atagatgactggcagcaaccaattcctaggacacaacaggtgctgagaatgcttttgcaagagtagtgtactacctatggtataat |
44188682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 220 - 315
Target Start/End: Complemental strand, 1329761 - 1329666
Alignment:
| Q |
220 |
ttgatatctcaaacggaccactgatattggtcttgtttagcagccaacaaacttgccttagtgtcccagcattttgtaatgctaattggacctatg |
315 |
Q |
| |
|
|||||||||||| |||||||| || ||||||| |||||||||||||||||||||||||||| | ||||||||||||||||||| ||||||||||| |
|
|
| T |
1329761 |
ttgatatctcaatgggaccactaattttggtctcgtttagcagccaacaaacttgccttagtctgccagcattttgtaatgctagttggacctatg |
1329666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University