View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12888_low_9 (Length: 257)

Name: NF12888_low_9
Description: NF12888
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12888_low_9
NF12888_low_9
[»] chr4 (1 HSPs)
chr4 (1-235)||(17797996-17798230)


Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 17798230 - 17797996
Alignment:
1 atatagacagaacacccaaaagaaaattcatacaccaaaacagacattcttcaaacattgccaaaggctaaaatatcttaaaacttaggttacaactata 100  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
17798230 atatagacagaacacacaaaagaaaattcatacaccaaaacagacattcttcaaacattgccaaaggctgaaatatcttaaaacttaggttacaactata 17798131  T
101 taatctattaattacaaatgaacttccaaagcaagagcatagagttgatgagaaaataaattgaagtaagaaagaaacaaaatgtatatatggttggcag 200  Q
    |||| || |||||||| | ||||||||||||||| | ||| |||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||    
17798130 taatttactaattacataggaacttccaaagcaaaaacattgagttgatgagaaaataaatggaagtaagaaagaaacaaaatgtgtatatggttggcag 17798031  T
201 gaagatgataaataaggtagcaggagtgagaagga 235  Q
    ||||||||||||||| |||||||||||||||||||    
17798030 gaagatgataaataatgtagcaggagtgagaagga 17797996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University