View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12889_low_3 (Length: 231)
Name: NF12889_low_3
Description: NF12889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12889_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 47579988 - 47580188
Alignment:
| Q |
19 |
caacttttcattcaaagggcttaaactcttgtatccatgttaaatttttcatgcaattcagcttctataagtttaggacttgaggatatataggattata |
118 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47579988 |
caacttttcattcaaagggcttgcactcttgtatccatgttaaatttttcatgcaattcagcttctataagtttaggacttgaggatatataggattata |
47580087 |
T |
 |
| Q |
119 |
ttgtatgattcttcccctttaatttttccaatcactgttgcagctggcaacttgtattgaagttgggcttccggcacttattgctatggttttcatctct |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47580088 |
ttgtatgattcttcccctttaatttttccaatcactgttgcagctggcaacttgtattgaagttgggcttccggcacttattgttatggttttcatctct |
47580187 |
T |
 |
| Q |
219 |
c |
219 |
Q |
| |
|
| |
|
|
| T |
47580188 |
c |
47580188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University