View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12889_low_4 (Length: 213)
Name: NF12889_low_4
Description: NF12889
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12889_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 47580166 - 47580369
Alignment:
| Q |
1 |
tattgctatggttttcatctctcaggcaagttaattagtgatttaaaatccattctttttcttaaattctggtactgaatgtgtttattgttttatatga |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47580166 |
tattgttatggttttcatctctcaggcaagttaattagtgatttaaaatccattctatttcttaaattctggtactgaatgtgtttattgttttatatga |
47580265 |
T |
|
| Q |
101 |
tgctgcagtatcttcattgttatataagcaccaagaagcctacatttgaccgatttgcagttctgttttccattgcaagtgcatggttatttgcacaggt |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
47580266 |
tgctgcagtatcttcatcgttatataagcaccaagaagcctacatttgaccgatttgcagttctgtttaccattgcaagtgcatggttatttgcacagct |
47580365 |
T |
|
| Q |
201 |
tctg |
204 |
Q |
| |
|
|||| |
|
|
| T |
47580366 |
tctg |
47580369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University