View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1288_high_14 (Length: 449)
Name: NF1288_high_14
Description: NF1288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1288_high_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 78; Significance: 4e-36; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 282 - 437
Target Start/End: Original strand, 2928431 - 2928583
Alignment:
| Q |
282 |
gctcagaaaattctaaaggtccatggtgattctagtatgattgctgattgcagggttgtatcaac---tagtctgtcaatctctggtgtactgtttcggc |
378 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||||| | ||| ||| ||||| |||||||||||||||||||||||||||| ||| |
|
|
| T |
2928431 |
gctcagaaaattcaaaaggtccatggtgattcaagtatgattgcag------gggctgtttcaacaactagtctgtcaatctctggtgtactgtttgggc |
2928524 |
T |
 |
| Q |
379 |
agtttttcagtttcttagatttgtgtattggagctgttctattgcgtttttcgtagtat |
437 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| ||||||| |||||| |
|
|
| T |
2928525 |
ggtttttcagtttcttagatttgtgtattggagttgttctattttgtttttcttagtat |
2928583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 389 - 437
Target Start/End: Complemental strand, 3002773 - 3002725
Alignment:
| Q |
389 |
tttcttagatttgtgtattggagctgttctattgcgtttttcgtagtat |
437 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3002773 |
tttcttatatttgtgtattggagctgttctattgcgtttttcttagtat |
3002725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 382 - 422
Target Start/End: Complemental strand, 37200292 - 37200252
Alignment:
| Q |
382 |
ttttcagtttcttagatttgtgtattggagctgttctattg |
422 |
Q |
| |
|
||||||||||||||| |||||||||||| |||| ||||||| |
|
|
| T |
37200292 |
ttttcagtttcttagttttgtgtattggggctgctctattg |
37200252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University