View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1288_high_30 (Length: 294)
Name: NF1288_high_30
Description: NF1288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1288_high_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 30 - 281
Target Start/End: Original strand, 29839290 - 29839541
Alignment:
| Q |
30 |
aatgtaatgtctgattcgaagccaataatttgtatggagaatctttcactagaataaggggaatgctcaatgtttagatactagatatcattagttttgt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29839290 |
aatgtaatgtctgattcgaagccaataatttgtatggagaatctttcactagaataaggggaatgctcaatgtttagatactagatatcattagttttgt |
29839389 |
T |
|
| Q |
130 |
tcacatccatattttatgtttattgatttcctttacnnnnnnnnnnccttcagggtgtagatatacaaattggaatggcgattgatagtgctaaagcaac |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29839390 |
tcacatccatattttatgtttattgatttcctttacttttttttttccttcagggtgtagatatacaaattggaatggcgattgatagtgctaaagcaac |
29839489 |
T |
|
| Q |
230 |
tcttgcagtgaagcgtagacttgcatgtgagatgctgaaatgttggcaacag |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29839490 |
tcttgcagtgaagcgtagacttgcatgtgagatgctgaaatgttggcaacag |
29839541 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 181 - 281
Target Start/End: Complemental strand, 34626026 - 34625926
Alignment:
| Q |
181 |
agggtgtagatatacaaattggaatggcgattgatagtgctaaagcaactcttgcagtgaagcgtagacttgcatgtgagatgctgaaatgttggcaaca |
280 |
Q |
| |
|
||||||||||||| ||| |||||||||| |||||||| | || || ||||| || ||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
34626026 |
agggtgtagatatccaacttggaatggcaattgatagcaccaaggccactctcgcggtgaagcgtagacttgcatgtgagatggtgaaatattggcaaca |
34625927 |
T |
|
| Q |
281 |
g |
281 |
Q |
| |
|
| |
|
|
| T |
34625926 |
g |
34625926 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University