View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1288_high_31 (Length: 289)
Name: NF1288_high_31
Description: NF1288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1288_high_31 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 29 - 289
Target Start/End: Complemental strand, 44013720 - 44013460
Alignment:
| Q |
29 |
agagtcagcctcatgaggagatggggaaaacctctcaacctttaatcaagcagtcatcaactcaatgctgagttttgtttttcattgtttctttgtttta |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44013720 |
agagtcagcctcatgaggagatggggaaaacctctcaacctttaatcaagcagtcatcaactcaatgctgagttttgtttttcattgtttctttgtttta |
44013621 |
T |
 |
| Q |
129 |
ataattagatgtaatggtggttagtgattgattttcatctcttcttagatgaaaacaagatggttgttaatgtgggaactttgagattagagtagaatcg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44013620 |
ataattagatgtaatggtggttagtgattgattttcatctcttcttagatgaaaacaagatggttgttaatgtgggaactttgagattagagtagaatcg |
44013521 |
T |
 |
| Q |
229 |
gctattgctgtacagttttagaaactaatatcatagatatcagttgtctgcaatattttgt |
289 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
44013520 |
gctattgctgtacagttttagaaattaatatcatagatatcagttgtctgcaatattttgt |
44013460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University