View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1288_high_42 (Length: 223)

Name: NF1288_high_42
Description: NF1288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1288_high_42
NF1288_high_42
[»] chr5 (1 HSPs)
chr5 (1-205)||(5501338-5501542)


Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 5501542 - 5501338
Alignment:
1 agaggcttcatccatgatgaaatataggtccaacattcgttatggaaaaattattattcgggatttccaaaagcttcagacaaagaaagatgtcaaacat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
5501542 agaggcttcatccatgatgaaatataggtccaacattcgttatggaaaaattattattcgggatttccaaaagcttcagacaaagaaagatgtcaagcat 5501443  T
101 tgtagggtttggacaaatgttgcgggacagattccatggattgagtgtctaaagagcatggagaaacccataatatgtgattttcttaagggtggatgtt 200  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
5501442 tgtagggtttggacaaatggtgcgggacagattccatggattgagtgtgtaaagagcatggagaaacccataatatgtgattttcttaagggtggatgtt 5501343  T
201 aacat 205  Q
    |||||    
5501342 aacat 5501338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University