View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1288_high_44 (Length: 206)

Name: NF1288_high_44
Description: NF1288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1288_high_44
NF1288_high_44
[»] chr8 (1 HSPs)
chr8 (117-202)||(39793435-39793520)


Alignment Details
Target: chr8 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 117 - 202
Target Start/End: Original strand, 39793435 - 39793520
Alignment:
117 ccctgcaacaggtttgtttctacttcccacaaaaatgggactgagcacaactaaagatcccatcatacgaagtggtgggttgccaa 202  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||    
39793435 ccctgcaacaggtttgtttctactttccacaaaaatgggactgagcacaactaaagataccatcatacgaagtggtaggttgccaa 39793520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University