View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1288_low_14 (Length: 471)
Name: NF1288_low_14
Description: NF1288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1288_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 224; Significance: 1e-123; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 160 - 395
Target Start/End: Original strand, 29052449 - 29052684
Alignment:
| Q |
160 |
ccaataggggagaaggctgcaacaaggtatactcttatgtccagtggtggttggagtacctgcactaaacgaagggtttgtggaataaggaagaaatgat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29052449 |
ccaataggggagaaggctgcaacaaggtatactcttatgtccagtggtggttggagtacctccactaaacgaagagtttgtggaataaggaagaaatgat |
29052548 |
T |
|
| Q |
260 |
gttgatgttggtggaagtaggaagatgatgagggtctcttcatgttaatccagctcatttattcatatatgttgcatgcttataatttatttcatagata |
359 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29052549 |
gttgatgttggtggaagtaggaagatgatgagggtctcttcatgttaatccagctcatttattcatatatgttgcatgcttataatttatttcatagata |
29052648 |
T |
|
| Q |
360 |
gacgacaattctatatctcaatgttcattaagcaaa |
395 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29052649 |
gacgacaattctatatctcaatgtgcattaagcaaa |
29052684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 8 - 163
Target Start/End: Original strand, 29052259 - 29052414
Alignment:
| Q |
8 |
ccaacaatattaaaaggtcttcgatcctaccttactgaaaaatgagaccagcaagggagaaaggaatttaggtaccattgatgcttggctgcaactggtg |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29052259 |
ccaaaaatattaaaaggtcttcgatcctaccttactgaaaaatgagaccagcaagggagaaaggaatttaggtaccattgatacttggctgcaactggtg |
29052358 |
T |
|
| Q |
108 |
aggcatgacagagggaagaaaatgactcgcaaatccagtacttcgacaaacaccaa |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29052359 |
aggcatgacagagggaagaaaatgactcgcaaatccagtacttcgacaaacaccaa |
29052414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 277 - 346
Target Start/End: Complemental strand, 33901414 - 33901343
Alignment:
| Q |
277 |
taggaagatgatg-agggtctcttcatgttaatccagc-tcatttattcatatatgttgcatgcttataatt |
346 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||| ||||| || | || |||||||||||||||||| |
|
|
| T |
33901414 |
taggaagatgatggaggctctcttcatgttaatccagcttcattcatgccgatctgttgcatgcttataatt |
33901343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 8e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 419 - 467
Target Start/End: Original strand, 779518 - 779566
Alignment:
| Q |
419 |
aacgatgagaagtccggggttgggacggagaagaaggatggggaaagtg |
467 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
779518 |
aacgatgagaagtccggggttgggacggagaagaaggatggggaaagtg |
779566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University