View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1288_low_16 (Length: 457)
Name: NF1288_low_16
Description: NF1288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1288_low_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 249; Significance: 1e-138; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 30 - 278
Target Start/End: Original strand, 30535913 - 30536161
Alignment:
| Q |
30 |
gattccaccaccgtaaccggtaacggaacaatggcgaattcgagaatgaggctgagattgaaccctaacaaggatcacaaaccagaaggttacgatgatc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30535913 |
gattccaccaccgtaaccggtaacggaacaatggcgaattcgagaatgaggctgagattgaaccctaacaaggatcacaaaccagaaggttacgatgatc |
30536012 |
T |
|
| Q |
130 |
ttgaattggatttcagtccttcgattttcagctcgttggagaaacatcttcctccgaatatgctcgttttttcgcgtgatgataaagctaaattcatgcg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30536013 |
ttgaattggatttcagtccttcgattttcagctcgttggagaaacatcttcctccgaatatgctcgttttttcgcgtgatgataaagctaaattcatgcg |
30536112 |
T |
|
| Q |
230 |
tgagattttgctcaagtatcttcctaatggtgaacgtcacagagtatgg |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30536113 |
tgagattttgctcaagtatcttcctaatggtgaacgtcacagagtatgg |
30536161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 333 - 427
Target Start/End: Original strand, 30536217 - 30536313
Alignment:
| Q |
333 |
ctatgaagctctgacacacaccgaatacgacactgacacgtcgacaccgatg--gcaatttaagaaaatcacacagctgaatgtaatcacatgtctc |
427 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30536217 |
ctatgaagctctgacacacaccgaatacaacactgacacgtcggcaccgatggcgcgatttaagaaaatcacacagctgaatgtaatcacatgtctc |
30536313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 350 - 422
Target Start/End: Original strand, 8623180 - 8623252
Alignment:
| Q |
350 |
acaccgaatacgacactgacacgtcgacaccgatggcaatttaagaaaatcacacagctgaatgtaatcacat |
422 |
Q |
| |
|
|||||| | ||||||||||||||| ||||||||| |||||| ||||||| ||| ||||||||||||||| |
|
|
| T |
8623180 |
acaccggacacgacactgacacgttgacaccgataacaattttagaaaatgacatcattgaatgtaatcacat |
8623252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000004; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 361 - 427
Target Start/End: Original strand, 29910694 - 29910760
Alignment:
| Q |
361 |
gacactgacacgtcgacaccgatggcaatttaagaaaatcacacagctgaatgtaatcacatgtctc |
427 |
Q |
| |
|
||||||||||||| ||||||| ||| ||||| ||||||| ||| | |||||||||||| ||||||| |
|
|
| T |
29910694 |
gacactgacacgtggacaccggtggaaatttgagaaaatgacagaattgaatgtaatcaaatgtctc |
29910760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 358 - 426
Target Start/End: Original strand, 18750859 - 18750927
Alignment:
| Q |
358 |
tacgacactgacacgtcgacaccgatggcaatttaagaaaatcacacagctgaatgtaatcacatgtct |
426 |
Q |
| |
|
|||||||||||||| |||||| || | ||||||||||||| ||| | ||||||||||||||||||| |
|
|
| T |
18750859 |
tacgacactgacacatcgacaacggtaataatttaagaaaatgacataattgaatgtaatcacatgtct |
18750927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 362 - 398
Target Start/End: Original strand, 31318700 - 31318736
Alignment:
| Q |
362 |
acactgacacgtcgacaccgatggcaatttaagaaaa |
398 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
31318700 |
acactgacacatcgacaccgatggtaatttaagaaaa |
31318736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University