View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1288_low_43 (Length: 286)
Name: NF1288_low_43
Description: NF1288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1288_low_43 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 52269983 - 52269726
Alignment:
| Q |
1 |
gtttgatgtatgatgtgaagtgatggtattcatatgtttaaaccaaagatttctctttataaaagagatcagcatttgctagtctttccgtgcgtttggg |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52269983 |
gtttgatgtatgatgtgaaatgatggtattcatatgtttaaaccaaagatttctgtttataaaagagatcagcatttgctagtctttccgtgcgtttggg |
52269884 |
T |
|
| Q |
101 |
ttttgctggccagttccctttgtggataccagagtaatgcagcaacaataatgatctcaaaattttcaatacaaatagagtggataattattagggaaac |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52269883 |
ttttgttggccagttccctttgtggataccagagtaatgcagcaacaataatgatctcaaaattttcaatacaaatagagtggataattattagggaaac |
52269784 |
T |
|
| Q |
201 |
ttacccacccatcttttatcttgtgtcaagtagtcttcgtattttatgacaaaatatt |
258 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52269783 |
ttacccacccatcttttattttgtgtcaagtagtcttcgtattttatgacaaaatatt |
52269726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University