View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1288_low_56 (Length: 250)

Name: NF1288_low_56
Description: NF1288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1288_low_56
NF1288_low_56
[»] chr1 (1 HSPs)
chr1 (9-250)||(44013177-44013418)


Alignment Details
Target: chr1 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 9 - 250
Target Start/End: Original strand, 44013177 - 44013418
Alignment:
9 gaataatattaaatgtctaaatcacttagttttgatgagactaatccaaaatgagcattttacatgtaattgtggagactaatctctcgactttgaacgg 108  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
44013177 gaataatattaaatgtctaaatcacttacttttgatgagactaatccaaaatgagcattttacatgtaattgtagagactaatctctcgactttgaacgg 44013276  T
109 gtcatatgggcaacttgtagcattttcatggctaaatttcaacttgatactcttactcttggttaaactagagacttgaattattgcttctaaatttcaa 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44013277 gtcatatgggcaacttgtagcattttcatggctaaatttcaacttgatactcttactcttggttaaactagagacttgaattattgcttctaaatttcaa 44013376  T
209 attcagatgttaaccacatgtgtcaaccagcatttgcaatta 250  Q
    ||||||||||||||||||||||||||||||||||||||||||    
44013377 attcagatgttaaccacatgtgtcaaccagcatttgcaatta 44013418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University