View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1288_low_57 (Length: 239)
Name: NF1288_low_57
Description: NF1288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1288_low_57 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 8 - 180
Target Start/End: Original strand, 44693167 - 44693339
Alignment:
| Q |
8 |
gccttaatatgccggcctgcctttattatgagtgaagttggaatccgaagttgtgtctattgagatagttgtttttgtgctgtttggtttgtctgctgaa |
107 |
Q |
| |
|
||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44693167 |
gccttaagataccggcctgcctttattatgagtgaagttggaatccgaagttgtgtctattgagatagttgtttttgtgctgtttggtttgtctgctgaa |
44693266 |
T |
 |
| Q |
108 |
ggtatcgttttctgtctggttttccttcgctggttgtctggttttcggggttgattccgtctctgtggtgctg |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44693267 |
ggtatcgttttctgtctggttttccttcgctagttgtctggttttcggggttgattccgtctcagtggtgctg |
44693339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University