View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1288_low_58 (Length: 238)
Name: NF1288_low_58
Description: NF1288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1288_low_58 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 22 - 223
Target Start/End: Original strand, 25482904 - 25483105
Alignment:
| Q |
22 |
acgggtacgtctctcttttgtactagtcggactttatagctcataagtgcttcgtgtttgtttggtgatgttgttgagttacaataaatagagacaaaga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25482904 |
acgggtacgtctctcttttgtactagtcggactttatagctcataagtgcttcgtgtttgtttggtgatgttgttgagttacaataaatagagacaaaga |
25483003 |
T |
|
| Q |
122 |
aaactcaaatgtgtcttttatttagcaacggtgacttttatttagcaacggtgatagtaaactattttcatccttcgacaataatatccattcccatgtg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25483004 |
aaactcaaatgtgtcttttatttagcaacggtgacttttatttagcaacggtgatagtaaactattttcatccttcgacaataatatccattcccatgtg |
25483103 |
T |
|
| Q |
222 |
at |
223 |
Q |
| |
|
|| |
|
|
| T |
25483104 |
at |
25483105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University