View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1288_low_59 (Length: 236)
Name: NF1288_low_59
Description: NF1288
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1288_low_59 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 18228324 - 18228096
Alignment:
| Q |
1 |
taacataaattttgtctatttcatttccctcgttctctatgtataactccaagcaattgagcattggattgtaataaactgatgacagtgatttcaaacg |
100 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18228324 |
taacaaaaattttgtctatttcacttccctcgttctctatgtataactccaagcaattgagcattggattgtaataaactgatgacagtgatttcaaacg |
18228225 |
T |
|
| Q |
101 |
agcttagcacgatagttgattagttctcccgttaacctttgataataatattcaagatagatgggtctaggaagcgactaaaagaggcgggtatttttgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
18228224 |
agcttagcacgatagttgattagttctcccgttaacctttgataataatattcaagatagatgggtctagggagcgactaaaagaggcgggtattcttgc |
18228125 |
T |
|
| Q |
201 |
tcttcaacatataattgtctttcatctca |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
18228124 |
tcttcaacatataattgtctttcatctca |
18228096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 135 - 228
Target Start/End: Complemental strand, 35389641 - 35389548
Alignment:
| Q |
135 |
acctttgataataatattcaagatagatgggtctaggaagcgactaaaagaggcgggtatttttgctcttcaacatataattgtctttcatctc |
228 |
Q |
| |
|
||||||||| |||||||||||||||||||||| | || ||| |||||| || |||||| | |||| ||||||||| |||||||| ||||| |
|
|
| T |
35389641 |
acctttgatgataatattcaagatagatgggtttggggagctgctaaaaccggaaggtattcatactctacaacatatagttgtcttttatctc |
35389548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University