View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1289-Insertion-4 (Length: 325)
Name: NF1289-Insertion-4
Description: NF1289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1289-Insertion-4 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 165 - 325
Target Start/End: Complemental strand, 8407679 - 8407519
Alignment:
| Q |
165 |
tgtctcaaatcaaacttgttcttaatttctaaaactgccggagactgaacttacagcatccattagctgctttatttcagattcactaagcttggatccc |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8407679 |
tgtctcaaatcaaacttgttcttaatttctaaaactgccggagactgaacttacagcatccattagctgctttatttcagattcactaagcttggatccc |
8407580 |
T |
 |
| Q |
265 |
aatttggacagtccagattttagttcttcatatgtgattgtgccacttcgatcagtatcta |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8407579 |
aatttggacagtccagattttagttcttcatatgtgattgtgccacttcgatcggtatcta |
8407519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 4 - 33
Target Start/End: Complemental strand, 8407851 - 8407822
Alignment:
| Q |
4 |
aacactagtgtctgtttgatgtgagaaaat |
33 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
8407851 |
aacactagtgtctgtttgatgtgagaaaat |
8407822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University