View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1289-Insertion-5 (Length: 170)
Name: NF1289-Insertion-5
Description: NF1289
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1289-Insertion-5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 81; Significance: 2e-38; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 8 - 92
Target Start/End: Complemental strand, 32616489 - 32616405
Alignment:
| Q |
8 |
gtacgcatgatcatcgtaacggccctggcttgcatcatcctctctgaacaactttttcttggaaggtactgttctgtgctaagca |
92 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32616489 |
gtacgtatgatcatcgtaacggccctggcttgcatcatcctctctgaacaactttttcttggaaggtactgttctgtgctaagca |
32616405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University